After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:1701
cDNA Description:ORF Clone of Influenza A H3N2 (A/Wisconsin/67/X-161/2005) HA DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:HA1, Hemagglutinin
Species:H3N2
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG11972-ACG$345
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG11972-ACR$345
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG11972-C$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG11972-CF$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG11972-CH$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG11972-CM$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG11972-CY$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG11972-NF$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG11972-NH$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG11972-NM$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG11972-NY$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG11972-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG11972-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"