Quick Order

Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H13N8 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) HA.
Gene Synonym:HA1, Hemagglutinin
Species:H13N8
Vector:pCMV3-untagged
Plasmid:pCMV3-H13N8-BN-00-HA
Restriction Site:KpnI + XbaI (6.1kb + 1.7kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAV91212.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H13N8 HA Gene Plasmid Map
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11721-ACG$345
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11721-ACR$345
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11721-C$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11721-CF$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11721-CH$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11721-CM$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11721-CY$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11721-NF$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11721-NH$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11721-NM$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11721-NY$315
Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11721-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11721-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"