Quick Order

Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetReviewsRelated ProductsProtocols
H9N2 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) HA.
Gene Synonym:HA1, Hemagglutinin
Species:H9N2
Vector:pCMV3-untagged
Plasmid:pCMV3-H9N2-GH-99-HA
Restriction Site:KpnI + XbaI (6.1kb + 1.68kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAO46082.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H9N2 HA Gene Plasmid Map
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11719-ACG$345
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11719-ACR$345
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11719-C$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11719-CF$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11719-CH$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11719-CM$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11719-CY$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11719-NF$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11719-NH$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11719-NM$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11719-NY$315
Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11719-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11719-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"