Quick Order

Text Size:AAA

Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
HAcDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1723
cDNA Description:ORF Clone of Influenza A H1N2 (A/swine/Guangxi/13/2006) HA DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG11703-ACG$345
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG11703-C$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG11703-CF$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG11703-CH$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG11703-CM$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG11703-CY$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG11703-NF$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG11703-NH$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG11703-NM$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG11703-NY$315
Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG11703-UT$315
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availsability:2-3 weeks