Quick Order

Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N2 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1717bp
cDNA Description:Full length Clone DNA of Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) HA.
Gene Synonym:HA1, Hemagglutinin
Species:H5N2
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACF47563.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11699-ACG$345
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11699-ACR$345
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11699-C$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11699-CF$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11699-CH$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11699-CM$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11699-CY$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11699-NF$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11699-NH$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11699-NM$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11699-NY$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11699-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11699-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"