After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H10N3 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1686bp
cDNA Description:Full length Clone DNA of Influenza A H10N3 (A/duck/Hong Kong/786/1979) HA.
Gene Synonym:HA1, Hemagglutinin
Species:H10N3
Vector:pCMV3-untagged
Plasmid:pCMV3-H10N3-DH-79-HA
Restriction Site:KpnI + XbaI (6.1kb + 1.69kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with BAF46762.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11693-ACG$345
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11693-ACR$345
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11693-C$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11693-CF$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11693-CH$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11693-CM$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11693-CY$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11693-NF$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11693-NH$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11693-NM$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11693-NY$315
Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11693-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11693-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"