After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human DCIR / CLEC4A / CLECSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4AcDNA Clone Product Information
cDNA Size:798
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 4, member A DNA.
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human DCIR / CLEC4A / CLECSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin superfamily member 6 (CLECSF6), is a single-pass type II C-type lectin receptor expressed mainly in dendritic cells (DCs), which is a negative regulator of DC expansion and has a crucial role in maintaining the homeostasis of the immune system. The Dectin-2 family of C-type lectins that includes Dectin-2, BDCA-2, DCIR, DCAR, Clecsf8 and Mincle. These type II receptors contain a single extracellular carbohydrate recognition domain and have diverse functions in both immunity and homeostasis. DCIR is the only member of the family which contains a cytoplasmic signalling motif and has been shown to act as an inhibitory receptor, while BDCA-2, Dectin-2, DCAR and Mincle all associate with FcRgamma chain to induce cellular activation, including phagocytosis and cytokine production. Dectin-2 and Mincle have been shown to act as pattern recognition receptors for fungi, while DCIR acts as an attachment factor for HIV. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. DCIR expressed on antigen presenting cells and granulocytes and acts as an inhibitory receptor via an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM). It may also be involved via its ITIM motif in the inhibition of B-cell-receptor-mediated calcium mobilization and protein tyrosine phosphorylation. Additionally, DCIR can participate in the capture of HIV-1 and promote infection in trans and in cis of autologous CD4(+) T cells from human immature monocyte-derived DCs. DCIR acts as a ligand for HIV-1 and is involved in events leading to productive virus infection.

  • Kanazawa N, et al. (2004) Signaling and immune regulatory role of the dendritic cell immunoreceptor (DCIR) family lectins: DCIR, DCAR, dectin-2 and BDCA-2. Immunobiology. 209(1-2): 179-90.
  • Fujikado N, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med. 14(2): 176-80.
  • Lambert AA, et al. (2008) The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood. 112(4): 1299-307.
  • Graham LM, et al. (2009) The Dectin-2 family of C-type lectins in immunity and homeostasis. Cytokine. 48(1-2): 148-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human DCIR / CLEC4A / CLECSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items