After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/New Caledonia/20/99) HA.
Gene Synonym:HA1, Hemagglutinin
Species:H1N1
Vector:pCMV3-untagged
Plasmid:pCMV3-H1N1-NC-99-HA
Restriction Site:KpnI + XbaI (6.1kb + 1.7kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP34324.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H1N1 HA Gene Plasmid Map
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11683-ACG$345
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11683-ACR$345
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11683-C$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11683-CF$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11683-CH$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11683-CM$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11683-CY$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11683-NF$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11683-NH$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11683-NM$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11683-NY$315
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11683-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11683-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"