After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human BNIPL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
BNIPLcDNA Clone Product Information
Gene Bank Ref.ID:BC027868.1
cDNA Size:1074
cDNA Description:ORF Clone of Homo sapiens BCL2/adenovirus E1B 19kD interacting protein like DNA.
Gene Synonym:PP753, BNIP-S, BNIPL-1, BNIPL-2, BNIPL
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

BNIP-2- like (BNIPL), also known as Bcl-2/adenovirus E1B 19 kDa interacting protein 2-like, is a apaptosis-associated protein that shares 72% homology with BNIP-2. BNIPL is highly expressed in human placenta and lung. There are two alternative splices: BNIPL-1 and BNIPL-2. Both BNIPL-1 and BNIPL-2 have a conserved arginine-patch motif in Rho protein family. BNIPL-1 has function in suppressing cell growth through binding to MIF (macrophage migration inhibitory factor) and GFER (growth factor erv1(saccharomyces cerevisiae)-like). BNIPL-2 may suppress the Cdc42GAP’s activity through ineracting with Cdc42GAP. BNIPL-2, containg a key BCH domain, which may induce the cell pseudopod growth, takes part in modulating cell migrations. Thus it suggested BNIPL-2 implicated in cell migration progresses and tumor translocation.

  • Shen L, et al. (2003) The apoptosis-associated protein BNIPL interacts with two cell proliferation-related proteins, MIF and GFER. FEBS. 540(1-3): 86-90.
  • Qin WX, et al. (2003) BNIPL-2, a novel homologue of BNIP-2, interacts with Bcl-2 and Cdc42GAP in apoptosis. Biochemical and Biophysical Research Communications. 308(2): 379-85.
  • Yasuda M, et al. (1999) BNIP3 alpha: a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res. 59 (3): 533-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks