Quick Order

Human CD53 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD53cDNA Clone Product Information
cDNA Size:660
cDNA Description:ORF Clone of Homo sapiens CD53 molecule DNA.
Gene Synonym:MOX44, TSPAN25, CD53
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks