After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat TPM4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat TPM4 cDNA Clone Product Information
Gene_bank_ref_id:NM_012678.2
RefSeq ORF Size:747bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tropomyosin 4.
Gene Synonym:Tpm4
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

TPM4, also known as tropomyosin 4, is a member of the tropomyosin family. Members of this family are actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM4 is expressed in cardiac tissue and platelets. It is highly expressed in the platelets of hypertensive patients. TPM4 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells it is implicated in stabilizing cytoskeleton actin filaments.

References
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Rostila A. et al., 2012, Lung Cancer. 77 (2): 450-9.
  • Vlahovich N. et al., 2008, Cell Motil Cytoskeleton. 65 (1): 73-85.
  • Size / Price
    Catalog: RG81616-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"