After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat VRK1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat VRK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001012194.1
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Rattus norvegicus vaccinia related kinase 1.
Gene Synonym:Vrk1
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

VRK1 is a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. Serine/threonine protein kinases are tumor suppressor that controls the activity of AMP-activated protein kinase family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. VRK1 contains 1 protein kinase domain and localizes to the nucleus. VRK1 gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. As a serine/threonine kinase, VRK1 phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Defects in VRK1 are the cause of pontocerebellar hypoplasia type 1 (PCH1), also called pontocerebellar hypoplasia with infantile spinal muscular atrophy or pontocerebellar hypoplasia with anterior horn cell disease. PCH1 is characterized by an abnormally small cerebellum and brainstem, central and peripheral motor dysfunction from birth, gliosis and anterior horn cell degeneration resembling infantile spinal muscular atrophy.

References
  • Sugimoto J, et al. (1999) Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus. J Hum Genet. 44 (2): 133-4.
  • Lopez-Borges S, et al. (2000) The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Oncogene. 19 (32): 3656-64.
  • Sevilla A, et al. (2004) c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Oncogene. 23 (55): 8950-8.
  • Size / Price
    Catalog: RG81611-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"