Quick Order

Text Size:AAA

Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NMNAT2cDNA Clone Product Information
Gene_bank_ref_id:NM_015039.2
cDNA Size:924
cDNA Description:ORF Clone of Homo sapiens nicotinamide nucleotide adenylyltransferase 2 DNA.
Gene Synonym:PNAT2, C1orf15, MGC2756, KIAA0479, NMNAT2
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name
Background

NMNAT2, also known as NMNAT-2, belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family. NMNAT is a central enzyme in NAD+ biosynthesis, transferring the adenylyl moiety of ATP to nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) resulting in the formation of NAD+ or NaAD+ and the release of pyrophosphate. NMNAT2 is predominantly expressed in human pancreas, insulinoma as well as in the brain, especially in the cerebrum, cerebellum, occipital lobe, frontal lobe, temporal lobe and putamen. Immunofluorescence microscopy localized endogenous NMNAT2 to the Golgi apparatus in human cell line. Endogenous NMNAT2 seem to be a labile axon survival factor, because specific depletion of NMNAT2 is sufficient to induce Wallerian-like degeneration of uninjured axons which endogenous NMNAT1 and NMNAT3 cannot prevent. Thus endogenous NMNAT2 represents an exciting new therapeutic target for axonal disorders.

References
  • Ljungberg MC. et al., 2012, Hum Mol Genet. 21 (2): 251-67.
  • Seki N. et al., 1998, DNA Res. 4 (5): 345-9.
  • Raffaelli N. et al., 2002, Biochem Biophys Res Commun. 297 (4): 835-40.
  • Sood R. et al., 2001, Genomics. 73 (2): 211-22.
  • Size / Price
    Catalog:HG11399-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"