After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat PPIL2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PPIL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001017383.1
RefSeq ORF Size:1566bp
cDNA Description:Full length Clone DNA of Rattus norvegicus peptidylprolyl isomerase (cyclophilin)-like 2.
Gene Synonym:Ppil2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PPIL2, is an enzyme which belongs to the cyclophilin family. The cyclophilins are peptidylprolyl isomerases and are highly conserved ubiquitous. They play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL2 interacts with the proteinase inhibitor eglin c and is localized in the nucleus. It contains 1 PPIL2 cyclophilin-type domain and 1 U-box domain. PPIL2 accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.

References
  • Grouse LH. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Payan DG. et al., 1996, Biochem J. 314 (1): 313-9.
  • Size / Price
    Catalog: RG81253-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"