After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CFL2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CFL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001108982.2
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cofilin 2, muscle.
Gene Synonym:Cfl2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

References
  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Size / Price
    Catalog: RG81236-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"