Quick Order

Text Size:AAA

Rat PON3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PON3 cDNA Clone Product Information
NCBI RefSeq:NM_001004086.1
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Rattus norvegicus paraoxonase 3.
Gene Synonym:Pon3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Draganov DI, et al. (2000) Rabbit serum paraoxonase 3 (PON3) is a high density lipoprotein-associated lactonase and protects low density lipoprotein against oxidation. J Biol Chem. 275(43): 33435-42.
  • Shih DM, et al. (2007) Decreased obesity and atherosclerosis in human paraoxonase 3 transgenic mice. Circ Res. 100(8): 1200-7.
  • Rosenblat M, et al. (2003) Mouse macrophage paraoxonase 2 activity is increased whereas cellular paraoxonase 3 activity is decreased under oxidative stress. Arterioscler Thromb Vasc Biol. 23(3): 468-74.
  • Size / Price
    Catalog: RG81169-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"