Quick Order

Rat BNIP3L natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat BNIP3L cDNA Clone Product Information
Gene_bank_ref_id:NM_080888.1
RefSeq ORF Size:657bp
cDNA Description:Full length Clone DNA of Rattus norvegicus BCL2/adenovirus E1B interacting protein 3-like.
Gene Synonym:Nix
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Imazu T, et al. (1999) Bcl-2 / E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl-2 / Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene. 18(32): 4523-9.
  • Sun JL, et al. (2004) Expression and structure of BNIP3L in lung cancer. Ai Zheng. 23(1): 8-14.
  • Size / Price
    Catalog: RG81156-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"