Quick Order

Text Size:AAA

Human IGSF3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGSF3cDNA Clone Product Information
cDNA Size:3645
cDNA Description:ORF Clone of Homo sapiens immunoglobulin superfamily, member 3, transcript variant 2 DNA.
Gene Synonym:V8, EWI-3, MGC117164, IGSF3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human IGSF3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Immunoglobulin superfamily member 3 (IGSF3), also known as Glu-Trp-Ile EWI motif-containing protein 3, IgSF3 and EWI-3 and IGSF3, is a single-pass type I membrane protein which belongs to the EWI subfamily of the Ig Superfamily of molecules. IGSF3 has an overall structural similarity and strong sequence similarity to V7, a human leukocyte surface protein. IGSF3 contains eight Ig-like C2-type (immunoglobulin-like) domains. IGSF3 is expressed in a wide range of tissues with high expression in Placenta, kidney and lung. EWI-2 is part of a novel Ig subfamily that includes EWI-F (F2alpha receptor regulatory protein (FPRP), CD9P-1 ), EWI-3 (IGSF3), and EWI-101 (CD101). All four members of this Ig subfamily contain a Glu-Trp-Ile (EWI) motif not seen in other Ig proteins. Human IGSF3 shares 92 % aa identity with mouse IGSF3.

  • Saupe S, et al. (1998) Molecular cloning of a human cDNA IGSF3 encoding an immunoglobulin-like membrane protein: expression and mapping to chromosome band 1p13. Genomics. 52(3): 305-11.
  • Lazaar AL, et al. (2001) VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. J Immunol. 166(1): 155-61.
  • Wetzel A, et al. (2004) Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). J Immunol. 172(6): 3850-9.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items