Quick Order

Rat CALR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CALRcDNA Clone Product Information
cDNA Size:1251
cDNA Description:ORF Clone of Rattus norvegicus calreticulin DNA.
Gene Synonym:Calr
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.

  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.
  • Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items