Quick Order

Rat CROT natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CROT cDNA Clone Product Information
Gene_bank_ref_id:NM_031987.1
RefSeq ORF Size:1839bp
cDNA Description:Full length Clone DNA of Rattus norvegicus carnitine O-octanoyltransferase.
Gene Synonym:Crot
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

References
  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • Size / Price
    Catalog: RG81062-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"