After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human DPEP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DPEP2cDNA Clone Product Information
Gene_bank_ref_id:BC024021
cDNA Size:1200
cDNA Description:ORF Clone of Homo sapiens dipeptidase 2 DNA.
Gene Synonym:UNQ284/PRO323, MBD2, DPEP2
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

DPEP2 (MBD-2) belongs to the membrane-bound dipeptidase family. There are three members of this family as membrane-bound dipeptidase-1 (MBD-1),membrane-bound dipeptidase-2 (MBD-2) and membrane-bound dipeptidase-3 (MBD-3).MBD-2 is expressed at highest levels in lung, heart, and testis and at some what lower levels in spleen.MBD-2 is membrane-bound through a glycosylphosphatidyl-inositol linkage and probably is a metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).It is generally recognized that rapid cleavage of LTD4 is important in inactivating the broncho-and vaso-constrictive effects of cysteinyl LTs in asthmatic and inflammatory processes.

References
  • Geetha M. Habib.et al.,2003,The FASEB Journal.8
  • Habib,G.M.,and Lieberman,M.W.1999,Adv.Exp.Med.Biol.469,295-300
  • Campbell, B. Jet al.,1984,J.Biol.Chem.259,14586-14590.
  • Size / Price
    Catalog:HG13806-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"