Quick Order

Text Size:AAA

Rat AKR1A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat AKR1A1 cDNA Clone Product Information
Gene_bank_ref_id:BC059133.1
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Rattus norvegicus aldo-keto reductase family 1, member A1 (aldehyde reductase).
Gene Synonym:Akr1a4
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.

References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • Size / Price
    Catalog: RG80786-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"