After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SLAMF8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLAMF8cDNA Clone Product Information
Gene_bank_ref_id:NM_020125.2
cDNA Size:858
cDNA Description:ORF Clone of Homo sapiens SLAM family member 8 DNA.
Gene Synonym:BLAME, SBBI42, FLJ20442, MGC129578
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

References
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Size / Price
    Catalog:HG11101-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"