After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human LTF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LTFcDNA Clone Product Information
cDNA Size:2133
cDNA Description:ORF Clone of Homo sapiens lactotransferrin DNA.
Gene Synonym:LF, HLF2, GIG12
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe3+ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.

  • Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.
  • Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.
  • Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.
  • Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks