Quick Order

Text Size:AAA

Human PRMT5 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRMT5 cDNA Clone Product Information
Gene_bank_ref_id:NM_006109.3
RefSeq ORF Size:1914bp
cDNA Description:Full length Clone DNA of Homo sapiens protein arginine methyltransferase 5 with N terminal Flag tag.
Gene Synonym:JBP1, SKB1, IBP72, SKB1Hs, HRMT1L5, PRMT5
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-PRMT5
Restriction Site:KpnI (two restriction sites) + XbaI (6kb + 0.51kb + 1.45kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 280 C/T, 468 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

References
  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Size / Price
    Catalog: HG11074-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"