Quick Order

Human NGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NGFcDNA Clone Product Information
cDNA Size:759
cDNA Description:ORF Clone of Homo sapiens nerve growth factor (beta polypeptide) DNA.
Gene Synonym:NGFB, HSAN5, Beta-NGF, MGC161426, MGC161428, NGF
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human NGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged, expression ready on other vectors
Neurotrophin & Receptor Related Products

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human NGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged, expression ready