After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL22RA2cDNA Clone Product Information
Gene_bank_ref_id:NM_181309.1
cDNA Size:696
cDNA Description:ORF Clone of Homo sapiens interleukin 22 receptor, alpha 2, transcript variant 2 DNA.
Gene Synonym:CRF2X, CRF2-10, CRF2-S1, IL-22BP, MGC150509, MGC150510, IL22RA2
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11025-ACG$325
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11025-ACR$325
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11025-CF$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11025-CH$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11025-CM$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11025-CY$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG11025-M$95
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11025-NF$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11025-NH$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11025-NM$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11025-NY$295
Human IL22BP / L22RA2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11025-UT$295
 Learn more about expression Vectors
IL-10 Family & Receptor Related Products
Background

Interleukin-22 receptor subunit alpha-2 (IL-22RA2), also known as interleukin-22-binding protein (IL-22BP), is a subunit of the receptor for interleukin 22. IL-22BP belongs to the type I I cytokine receptor family and contains 3 fibronectin type-III domains. IL-22BP/IL-22RA2 is expressed in a range of tissues, including those in the digestive, female reproductive, and immune systems. It is expressed in placenta, spleen, breast, skin and lung. It is also detected in intestinal tract, testis, brain, heart and thymus. The dominant cell types expressing IL-22BP/IL-22RA2 were mononuclear cells and epithelium. IL-22BP/IL-22RA2 may play an important role as an IL-22 antagonist in the regulation of inflammatory responses. Interleukin-22 (IL-22) is a member of IL-10 family. It is produced by T cells and induces the production of acute-phase reactants. IL-22 plays important roles in immune response through activation of the STAT 3 signal transduction pathway. Two types of IL-22-binding receptor have been discovered, a membrane-bound receptor and a soluble receptor.

References
  • Whittington HA, et al. (2004) Interleukin-22: a potential immunomodulatory molecule in the lung. Am J Respir Cell Mol Biol. 31(2): 220-6.
  • Dumoutier L, et al. (2001) Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J Immunol. 166(12): 7090-5.
  • Wei CC, et al. (2003) Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4(3): 204-11.
  • Size / Price
    Catalog:HG11025-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"