Quick Order

Human QPCT ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human QPCT cDNA Clone Product Information
Gene_bank_ref_id:BC047756
RefSeq ORF Size:1086bp
cDNA Description:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with C terminal Flag tag.
Gene Synonym:GCT, QC, sQC, QPCT
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

References
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catalog: HG13752-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"