Quick Order

Human TNNC1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNNC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003280.2
RefSeq ORF Size:486bp
cDNA Description:Full length Clone DNA of Homo sapiens troponin C type 1 (slow) with N terminal Flag tag.
Gene Synonym:TNC, TNNC, CMD1Z
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Troponin I, also known as TNNC1, is part of the troponin complex. This complex contains 3 subunits: troponin I (TnI), troponin T (TnT) and troponin C (TnC). Troponin I is the inhibitory subunit, blocking actin-myosin interactions and thereby mediating striated muscle relaxation. It binds to actin in thin myofilaments to hold the actin-tropomyosin complex in place. Because of it myosin cannot bind actin in relaxed muscle. When calcium binds to the Troponin C it causes conformational changes which lead to dislocation of troponin I and finally tropomyosin leaves the binding site for myosin on actin leading to contraction of muscle.

References
  • Kalaji FR. et al., 2012, Saudi J Kidney Dis Transpl. 23 (5): 939-45.
  • Wijnker PJ. et al., 2013, Am J Physiol Heart Circ Physiol. 304 (2): H260-8.
  • Solaro RJ. et al., 2013, Circ Res. 112 (2): 355-66.
  • Size / Price
    Catalog: HG11011-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"