After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIAA0101cDNA Clone Product Information
Gene_bank_ref_id:NM_014736.4
cDNA Size:336
cDNA Description:ORF Clone of Homo sapiens platelet-activating factor DNA.
Gene Synonym:L5, PAF, OEATC1, NS5ATP9, OEATC-1, p15(PAF), KIAA0101
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10997-ACG$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10997-ACR$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10997-ANG$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10997-ANR$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10997-CF$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10997-CH$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10997-CM$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10997-CY$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone)HG10997-M$95
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10997-M-F$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10997-M-N$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10997-NF$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10997-NH$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10997-NM$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10997-NY$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10997-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

References
  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Size / Price
    Catalog:HG10997-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"