After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat YWHAH natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat YWHAH cDNA Clone Product Information
NCBI RefSeq:NM_013052.1
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Rattus norvegicus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide.
Gene Synonym:Ywhah
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Wakui H, et al. (1997) Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem. 272(13): 8153-6.
  • Toyooka K, et al. (2002) Isolation and structure of the mouse 14-3-3 eta chain gene and the distribution of 14-3-3 eta mRNA in the mouse brain. Brain Res Mol Brain Res. 100(1-2): 13-20.
  • Kim YS, et al. (2005) Role of 14-3-3 eta as a positive regulator of the glucocorticoid receptor transcriptional activation. Endocrinology. 146(7): 3133-40.
  • Grover D, et al. (2009) Family-based association of YWHAH in psychotic bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 150B(7): 977-83.
  • Size / Price
    Catalog: RG80661-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"