After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CCL8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CCL8cDNA Clone Product Information
Gene Bank Ref.ID:NM_005623.2
cDNA Size:300
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 8 DNA.
Gene Synonym:HC14, MCP2, MCP-2, SCYA8, SCYA10
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Chemokine & Receptor Related Products
Product nameProduct name
Canine XCL1 Protein (His Tag)Human CXCL2 / MIP-2 ProteinRat CXCL1 / MGSA / NAP-3 ProteinRat CXCL2 / MIP-2 ProteinHuman CCL20 / MIP-3 alpha Protein (His Tag)Rat CCL3 / Mip1a ProteinHuman FAM19A4 / TAFA4 Protein (Fc Tag)Human CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL23 / MIP 3 Protein (His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 49-109, His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 40-113, His Tag)Mouse CCL22 / MDC Protein (His Tag)Mouse CXCL14 / BRAK ProteinMouse CXCL1 / MGSA / NAP-3 ProteinHuman NAP-2 / PPBP / CXCL7 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human I-309 / CCL1 / TCA-3 ProteinHuman CCL13 / MCP-4 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human CXCL12 / SDF1b Protein (Fc Tag)Human CXCL12 / SDF-1 ProteinHuman CCL18 / PARC / MIP4 Protein (His Tag)Human CCL22 / MDC Protein (His Tag)Human CCL17 / TARC / SCYA17 Protein (His Tag)Human CCL17 / TARC / SCYA17 ProteinHuman CCL11 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (aa 28-93, His Tag)Human CCL21 / 6Ckine ProteinMouse CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL27 / CTACK Protein (His Tag)Human Fractalkine / CX3CL1 Protein (His Tag)Human XCL1 Protein (His Tag)Human CXCL10 / Crg-2 ProteinHuman CXCL4 / PF4 ProteinHuman CXCL1 / MGSA / NAP-3 Protein (His & NusA Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & SUMO Tag)Human CXCL14 / BRAK ProteinHuman CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CXCL5 ProteinHuman CCL15 / MIP-5 / MIP-1 delta Protein (aa 22-113, His Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 46-113, His Tag)Human CCL5 / RANTES Protein (His & mucin Tag)Human CCL24 / Eotaxin-2 / MPIF-2 Protein (His Tag)Human CCL8 / MCP-2 Protein (SUMO Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL4 / MIP1B Protein (His Tag)Human CCL3 / Mip1a Protein (His Tag)Human CXCL3 / GRO gamma Protein (His Tag)Human FAM19A2 Protein (Fc Tag)Human MCP-3 / CCL7 Protein (His Tag)Human MCP-3 / CCL7 Protein (His Tag)Cynomolgus / Rhesus Fractalkine / CX3CL1 Protein (Fc Tag)Human XCL2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a, His Tag)Human CXCL12 / SDF-1 Protein (isoform a)Human CXCL1 / MGSA / NAP-3 ProteinMouse CXCL12 / SDF-1 ProteinMouse CCL6 / C-C motif ligand 6 Protein (His Tag)Mouse CCL17 / TARC ProteinMouse CCL20 / MIP-3 alpha Protein (His Tag)Mouse CXCL2 / GRO2 / MIP-2 (His & SUMO Tag)Mouse CXCL16 / SR-PSOX Protein (His Tag)Mouse CXCL9 / MIG / C-X-C motif chemokine 9 ProteinMouse I-309 / CCL1 / TCA-3 Protein (Fc Tag)Mouse CCL8 / MCP-2 Protein (His & NusA Tag)Mouse XCL1 Protein (His Tag)Human CCL28 Protein (His Tag)Mouse CCL3 / Mip1a ProteinCanine IL-8 / CXCL8 ProteinCanine CXCL12 / SDF-1 ProteinCanine CXCL13 / BCA-1 Protein (His Tag)Canine CXCL16 / SR-PSOX Protein (His Tag)Rat NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (His Tag)Cynomolgus CXCL12 / SDF-1 Protein (Fc Tag)Cynomolgus CXCL13 / BCA-1 / BLC Protein (His Tag)Cynomolgus CCL17 / TARC Protein (His Tag)Cynomolgus XCL1 Protein (His Tag)Cynomolgus NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Cynomolgus CXCL9 / MIG / C-X-C motif chemokine 9 ProteinCynomolgus CCL21 / 6Ckine ProteinCynomolgus IL-8 / CXCL8 ProteinMouse MCP-3 / CCL7 Protein (His Tag)Human CCL5 / RANTES ProteinHuman CCL23 / MIP 3 Protein (His Tag)Human CCL23 / MIP 3 ProteinCanine CXCL16 / SR-PSOX Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.

    CCL8/MCP-2 related areas, pathways, and other information

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks