After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD2cDNA Clone Product Information
cDNA Size:1056
cDNA Description:ORF Clone of Homo sapiens CD2 molecule DNA.
Gene Synonym:T11, SRBC
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.