Quick Order

Human APLP1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human APLP1 cDNA Clone Product Information
Gene_bank_ref_id:BC012889
RefSeq ORF Size:1953bp
cDNA Description:Full length Clone DNA of Homo sapiens amyloid beta (A4) precursor-like protein 1 with C terminal Flag tag.
Gene Synonym:APLP, APLP1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

References
  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    Catalog: HG13716-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"