Quick Order

Text Size:AAA

Human PNLIPRP2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PNLIPRP2 cDNA Clone Product Information
NCBI RefSeq:BC005989
RefSeq ORF Size:1410bp
cDNA Description:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 2 with C terminal Flag tag.
Gene Synonym:PLRP2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.

References
  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • Size / Price
    Catalog: HG13687-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"