Quick Order

Rat ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANXA5cDNA Clone Product Information
Gene_bank_ref_id:NM_013132.1
cDNA Size:960
cDNA Description:ORF Clone of Rattus norvegicus annexin A5 DNA.
Gene Synonym:LC5, Anx5
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
References
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catalog:RG80610-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"