Quick Order

Human ENTPD3 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENTPD3 cDNA Clone Product Information
NCBI RefSeq:NM_001248.2
RefSeq ORF Size:1509bp
cDNA Description:Full length Clone DNA of Homo sapiens ectonucleoside triphosphate diphosphohydrolase 3 with N terminal Flag tag.
Gene Synonym:HB6, CD39L3, FLJ93839, NTPDase-3
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
References
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • Size / Price
    Catalog: HG10909-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"