Quick Order

Text Size:AAA

Rat AK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AK1cDNA Clone Product Information
cDNA Size:585
cDNA Description:ORF Clone of Rattus norvegicus adenylate kinase 1 DNA.
Gene Synonym:Ak1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
  • Lu Q, et al. (1996) Adenylate kinase complements nucleoside diphosphate kinase deficiency in nucleotide metabolism. Proc Natl Acad Sci. 93 (12): 5720-5.
  • Dzeja P, et al. (2009) Adenylate kinase and AMP signaling networks: Metabolic monitoring, signal communication and body energy sensing. Int J Mol Sci. 10 (4): 1729-72.
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106 - 11.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items