After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat ENO1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ENO1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012554.3
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Rattus norvegicus enolase 1, (alpha).
Gene Synonym:Nne
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catalog: RG80578-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"