Quick Order

Human CCL24 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL24 cDNA Clone Product Information
Gene_bank_ref_id:NM_002991.2
RefSeq ORF Size:360bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 24 with N terminal Flag tag.
Gene Synonym:Ckb-6, MPIF2, MPIF-2, SCYA24
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Background

CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL24 displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. CCL24 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. CCL24 is chemotactic for resting T-lymphocytes, and eosinophils. It has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. It is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Eotaxin-2 interacts with chemokine receptor CCR3 to induce chemotaxis in eosinophils. Elevated level of Eotaxin-2 has been seen in patients with aspirin-exacerbated respiratory disease.

References
  • Manousou P, et al. (2010) Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies. Clin Exp Immunol. 162 (2): 337-47.
  • Owczarek W, et al. (2010) Analysis of eotaxin 1/CCL11, eotaxin 2/CCL24 and eotaxin 3/CCL26 expression in lesional and non-lesional skin of patients with atopic dermatitis. Cytokine. 50 (2): 181-5.
  • Luesink M, et al. (2009) Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome. Blood. 114 (27): 5512-21.
  • Size / Price
    Catalog: HG10901-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"