Quick Order

Text Size:AAA

Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK5cDNA Clone Product Information
cDNA Size:918
cDNA Description:ORF Clone of Homo sapiens cyclin-dependent kinase 5 DNA.
Gene Synonym:PSSALRE
Restriction Site:HindIII + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10897-ACG$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10897-ACR$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10897-ANG$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10897-ANR$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10897-CF$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10897-CH$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10897-CM$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10897-CY$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone)HG10897-M$95
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10897-M-F$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10897-M-N$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10897-NF$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10897-NH$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10897-NM$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10897-NY$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10897-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II catalytic subunit, TPKII catalytic subunit and CDK5, is a cytoplasm protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and CDC2 / CDKX subfamily. Cyclin-dependent kinases (Cdks) are a family of proline-directed Ser/Thr kinases known for their role in the control of cell cycle progression. In 1992, this family was joined by CDK5, which is an atypical member in that it uses its own activators and is multifunctional, playing important regulatory roles in multiple cellular functions. CDK5, unlike other Cdks, is not regulated by cyclins, and its activity is primarily detected in postmitotic neurons in developing and adult nervous systems. CDK5 is activated by association with a neuron-specific activator, p35 or its isoform p39. CDK5 is probably involved in the control of the cell cycle. It interacts with D1 and D3-type G1 cyclins. CDK5 can phosphorylate histone H1, tau, MAP2 and NF-H and NF-M. It also interacts with p35 which activates the kinase. CDK5 plays important roles in various neuronal activities, including neuronal migration, synaptic activity, and neuronal cell death.

  • Smith,D.S. et al., 2001, Cell Growth Differ. 12 (6):277-83.
  • Mapelli,M. et al., 2003, Neurosignals.  12 (4-5):164-72.
  • Cheng,K. et al., 2003, Neurosignals. 12 (4-5):180-90.
  • Fischer,A. et al., 2003, Curr Drug Targets CNS Neurol Disord 2 (6): 375 - 81.
  • Lalioti,V. et al., 2010, Cell Cycle  9 (2): 284-311.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items