Quick Order

Text Size:AAA

Rat PKM natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PKM cDNA Clone Product Information
Gene_bank_ref_id:NM_053297.2
RefSeq ORF Size:1596bp
cDNA Description:Full length Clone DNA of Rattus norvegicus pyruvate kinase, muscle.
Gene Synonym:Pk3, Pkm2, PKM12
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Pyruvate kinase isozymes M2 also known as pyruvate kinase muscle isozyme 2 (PKM2), pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1), or opa-interacting protein 3 (OIP3), is an isoenzyme of the glycolytic enzyme pyruvate kinase. Pyruvate kinase isozymes M2 / PKM2 is a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. PKM2 has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. PKM2 has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. PKM2 functions as a glycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. PKM2 may stimulates POU5F1-mediated transcriptional activation. This protein Plays a general role in caspase independent cell death of tumor cells. The ratio betwween the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms of PKM2 contributes to the control of glycolysis and is important for tumor cell proliferation and survival.

References
  • Bluemlein K, et al. (2011) No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2 (5): 393-400.
  • Gupta V, et al. (2010) Dominant Negative Mutations Affect Oligomerization of Human Pyruvate Kinase M2 Isozyme and Promote Cellular Growth and Polyploidy. J Biol Chem. 285 (22): 16864-73.
  • Eigenbrodt E, et al. (1992) Double role for pyruvate kinase type M2 in the expansion of phosphometabolite pools found in tumor cells. Crit Rev Oncog. 3 (1): 91-115.
  • Size / Price
    Catalog: RG80568-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"