After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GPR114 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPR114 cDNA Clone Product Information
Gene_bank_ref_id:NM_153837.1
RefSeq ORF Size:1587bp
cDNA Description:Full length Clone DNA of Homo sapiens G protein-coupled receptor 114 with N terminal Flag tag.
Gene Synonym:PGR27, GPR114
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

GPR114 belongs to the G-protein coupled receptor 2 family. Members of this family share a common molecular architecture which consists of seven transmembrane domains, three extracellular loops, three intracellular loops, an amino-terminal extracellular domain and an intracellular carboxyl terminus. It is thought that light acts as the activating stimulus of a G-protein-coupled receptor (GPCR). GPCRs are expected to have molecular function (G-protein coupled receptor activity) and to localize in various compartments (endoplasmic reticulum membrane, plasma membrane, integral to membrane). Family B of the GPCRs is a small but structurally and functionally diverse group of proteins that includes receptors for polypeptide hormones, molecules thought to mediate intercellular interactions at the plasma membrane and a group of Drosophila proteins that regulate stress responses and longevity. GPR114 contains 1 GPS domain. GPR114 gene has been proposed to participate in processes (G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway).

References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Bjarnadttir TK, et al. (2005) The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. Genomics. 84(1):23-33.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog: HG10854-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"