After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat TGM2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TGM2cDNA Clone Product Information
Gene_bank_ref_id:NM_019386.2
cDNA Size:2061
cDNA Description:ORF Clone of Rattus norvegicus transglutaminase 2, C polypeptide DNA.
Gene Synonym:TgaseII
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Protein-glutamine gamma-glutamyltransferase 2, also known as Tissue transglutaminase, Transglutaminase C, Transglutaminase-2, and TGM2, is a member of the transglutaminase superfamily. TGM2 plays a role in cell growth and survival through the anti-apoptosis signaling pathway. It is a calcium-dependent acyltransferase which also undergoes a GTP-binding/GTPase cycle even though it lacks any obvious sequence similarity with canonical GTP-binding (G) proteins. TGM2 is a multi-functional protein which catalyzes transamidation reactions or acts as a G-protein in intracellular signalling. As an enzyme which is responsible for the majority of transglutaminase (TG) activity in the brain, TGM2 is likely to play a modulatory role in nervous system development and has regulatory effect on neuronal cell death as well. Most importantly, numerous studies have presented data demonstrating that dysregulation of TGM2 may contribute to the pathogenesis of many neurodegenerative disorders, including Huntington's disease, Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis as well as nervous system injuries.

References
  • Ruan Q, et al. (2007) Transglutaminase 2 in neurodegenerative disorders. Front Biosci. 12: 891-904.
  • Ai L, et al. (2008) The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis. 29(3): 510-8.
  • Filiano AJ, et al. (2010) Transglutaminase 2 protects against ischemic stroke. Neurobiol Dis. 39(3): 334-43.
  • Park D, et al. (2010) Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids. 39(3): 619-31.
  • Miyoshi N, et al. (2010) TGM2 is a novel marker for prognosis and therapeutic target in colorectal cancer. Ann Surg Oncol. 17(4): 967-72.
  • Size / Price
    Catalog:RG80519-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"