After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ADAMTSL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADAMTSL1cDNA Clone Product Information
Gene_bank_ref_id:BC030262
cDNA Size:1320
cDNA Description:ORF Clone of Homo sapiens ADAMTS-like 1 DNA.
Gene Synonym:C9orf94, PUNCTIN, ADAMTSR1, ADAMTSL-1, ADAMTSL1
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins and ADAM protein family contain a disintegrin and a metalloprotease domain. Metallospondins is collective term for members of ADAMTS protein family. ADAMTS proteins lack the EGF-like domain found normally in members of the ADAM protein family. They also do not possess the canonical disintegrin sequence found in the ADAM protein family. It contains the domains found in members of the ADAMTS protein family with the exception of the pro-metalloprotease and the disintegrin-like domain typical of this family. ADAMTSL1 gene is expressed in adult skeletal muscle. ADAMTSL1 may play an important role in the extracellular matrix as it is deposited in the cell substratum in a punctate fashion and is excluded from focal contacts.

References
  • Hirohata S, et al. (2002) Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 277 (14): 12182-9.
  • Wang LW, et al. (2007) O-fucosylation of thrombospondin type 1 repeats in ADAMTS-like-1/punctin-1 regulates secretion: implications for the ADAMTS superfamily. J Biol Chem. 282 (23): 17024-31.
  • Hall NG, et al. (2004) ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. 22 (6): 501-10.
  • Size / Price
    Catalog:HG13550-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"