After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GIF ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GIF cDNA Clone Product Information
Gene_bank_ref_id:BC037958
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Homo sapiens gastric intrinsic factor (vitamin B synthesis) with C terminal Flag tag.
Gene Synonym:IF, INF, IFMH, TCN3, GIF
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Gastric intrinsic factor, also known as GIF, belongs to the of the cobalamin transport protein family. It is a glycoprotein produced by the parietal cells of the stomach. Gastric intrinsic factor plays a key role in the absorption of vitamin B12 on in the small intestine. Vitamin B12 bounds to haptocorrin after entry into the stomach. The resulting complex enters the duodenum, where pancreatic enzymes digest haptocorrin. In the less acidic environment of the small intestine, B12 can then bind to gastric intrinsic factor. This new complex travels to the ileum, where special epithelial cells endocytose them. Inside the cell, B12 dissociates once again and binds to another protein, transcobalamin II. The new complex can exit the epithelial cells to enter the liver.

References
  • Gerdin AK. (2010) The Sanger Mouse Genetics Programme: high throughput characterisation of knockout mice. Acta Opthalmologica. 88:925-7.
  • AU - Berlin H, et al. (1968) ORAL TREATMENT OF PERNICIOUS ANEMIA WITH HIGH DOSES OF VITAMIN B12 WITHOUT INTRINSIC FACTOR. Acta Medica Scandinavica. 184(1-6):247-58.
  • Hewitt JE, et al. (1991) Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics. 10(2):432-40.
  • Size / Price
    Catalog: HG13544-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"