Quick Order

Rat PDCD1LG2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PDCD1LG2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001107582.2
RefSeq ORF Size:807bp
cDNA Description:Full length Clone DNA of Rattus norvegicus programmedcelldeath1ligand2.
Gene Synonym:Pdcd1lg2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.

References
  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.
  • Size / Price
    Catalog: RG80454-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"