Quick Order

Human RNASET2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RNASET2 cDNA Clone Product Information
NCBI RefSeq:BC001660
RefSeq ORF Size:771bp
cDNA Description:Full length Clone DNA of Homo sapiens ribonuclease T2 with C terminal Flag tag.
Gene Synonym:RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

RNASET2 (ribonuclease T2) is an enzyme which belongs to the RNase T2 family. It is highly expressed in the temporal lobe and fetal brain. RNASET2 gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. Defects in RNASET2 are the cause of leukoencephalopathy cystic without megalencephaly. An infantile-onset syndrome of cerebral leukoencephalopathy. Affected newborns develop microcephaly and neurologic abnormalities including psychomotor impairment, seizures and sensorineural hearing impairment. The brain shows multifocal white matter lesions, anterior temporal lobe subcortical cysts, pericystic abnormal myelination, ventriculomegaly and intracranial calcifications.

References
  • Acquati F, et al. (2011) A Molecular signature induced by RNASET2, a tumor antagonizing gene, in ovarian cancer cells. Oncotarget. 2(6):477-84.
  • Campomenosi P, et al. (2011) Comparison of the baculovirus-insect cell and Pichia pastoris heterologous systems for the expression of the human tumor suppressor protein RNASET2. Biotechnol Appl Biochem. 58(1):39-49.
  • Monti L, et al. (2008) RNASET2 as a tumor antagonizing gene in a melanoma cancer model. Oncol Res. 17(2):69-74.
  • Size / Price
    Catalog: HG13509-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"