Quick Order

Text Size:AAA

Human SUSD4 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SUSD4 cDNA Clone Product Information
NCBI RefSeq:BC004888
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens sushi domain containing 4 with C terminal Flag tag.
Gene Synonym:PRO222, RP11-239E10.4, SUSD4
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SUSD4, also known as sushi domain-containing protein 4, is a hypothetical cell surface protein whose tissue distribution and function are completely unknown. SUSD4 is detectable in murine brains, eyes, spinal cords, and testis but not other tissues. In brains, SUSD4 is highly expressed in the white matter on oligodendrocytes/axons, and in eyes, it is exclusively expressed on the photoreceptor outer segments. In in vitro complement assays, SUSD4 augments the alternative but not the classical pathway of complement activation at the C3 convertase step. SUSD4 deficiency may cause autism or Fryns syndrome, both of which are genetic diseases with severe abnormal neurological development and/or functions.

References
  • Kimura K. et al., 2006, Genome Res. 16 (1): 55-65.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Tu Z. et al., 2010, Am J Pathol. 176 (5): 2378-84.
  • Size / Price
    Catalog: HG13488-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"