Quick Order

Rat SPN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPNcDNA Clone Product Information
Gene_bank_ref_id:NM_001271086.1
cDNA Size:1173
cDNA Description:ORF Clone of Rattus norvegicus persephin DNA.
Gene Synonym:PSP, PspnS
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

References
  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
  • Size / Price
    Catalog:RG80432-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"